Anti-Tubulin β Antibody (A24866)

EGFR-targeted cancer therapy is a breakthrough in non-small cell carcinoma. miRNAs have been proved to play important roles in cancer. Currently, for the role of miRNAs in EGFR-targeted cancer therapy is unclear. In this study, first we found that erlotinib reduced the expression of miR-9. MiR-9 expression was increased in human lung cancer tissues compared with peripheral normal tissues, and miR-9 promoted the growth of NSCLC cells. Overexpression of miR-9 decreased the growth inhibitory effect of erlotinib. Second, miR-9 decreased FoxO1 expression by directly inhibition of its mRNA translation. Adenovirus-mediated overexpression of FoxO1 or siRNA-mediated downregulation of FoxO1 negatively regulated cell growth. And exogenous overexpression FoxO1 reduced the pro-growth effect of miR-9. Finally, we found that erlotinib upregulated FoxO1 protein expression. Moreover, overexpression of miR-9 decreased erlotinib-induced FoxO1 expression, and overexpression of FoxO1 enhanced the growth inhibitory effects of erlotinib. Additionally, we found that erlotinib downregulates miR-9 expression through suppressing the transcrption of miR-9-1 and enhanced DNA methylation maybe involved. These findings suggest that oncogenic miR-9 targeted FoxO1 to promote cell growth, and downregulation of this axis was involved in erlotinib's growth inhibitory effects. Clarifying the regulation of miRNAs by erlotinib may indicate novel strategies for enhancing EGFR-targeted cancer therapy.

Pigment epithelial-derived factor (PEDF) is a potent anti-angiogenic factor whose effects are partially mediated through the induction of endothelial cell apoptosis. However, the underlying mechanism for PEDF and the functional PEDF peptides 34-mer and 44-mer to inhibit angiogenesis in the heart has not been fully established. In the present study, by constructing adult Sprague-Dawley rat models of acute myocardial infarction (AMI) and in vitro myocardial angiogenesis, we showed that PEDF and 34-mer markedly inhibits angiogenesis by selectively inducing tip cells apoptosis rather than quiescent cells. Peptide 44-mer on the other hand exhibits no such effects. Next, we identified Fas death pathway as essential downstream regulators of PEDF and 34-mer activities in inhibiting angiogenesis. By using peroxisome proliferator-activated receptor γ (PPAR-γ) siRNA and PPAR-γ inhibitor, GW9662, we found the effects of PEDF and 34-mer were extensively blocked. These data suggest that PEDF and 34-mer inhibit angiogenesis via inducing tip cells apoptosis at least by means of up-regulating PPAR-γ to increase surface FasL in the ischemic heart, which might be a novel mechanism to understanding cardiac angiogenesis after AMI.

G protein-coupled receptor 43/free fatty acid receptor 2 (GPR43/FFAR2) is essential for polymorphonuclear (PMN) recruitment. We investigated the expression of GPR43/FFAR2 in the colon from Crohn's disease patients and whether dietary fiber in enteral nutrition increases GPR43+ polymorphonuclear infiltration in mucosa. Segments of ascending colon and white blood cells from peripheral blood were obtained from 46 Crohn's disease patients and 10 colon cancer patients. The Crohn's disease patients were grouped by the activity of disease (active or remission) and enteral nutrition with or without dietary fiber. Histological feature, expression and location of GPR43/FFAR2 and level of tumor necrosis factor-α (TNF-α), interleukine-6 (IL-6) and myeloperoxidase were assessed. The results of hematoxylin-eosin and immunohistochemistry staining revealed that the infiltration of immune cells, including GPR43+ PMN, was more severe in active Crohn's disease patients who consumed normal food or enteral nutrition with dietary fiber than in remission patients and colon cancer patients. This finding was supported by the results of GPR43 and myeloperoxidase expression. Active Crohn's disease (CD) patients who consumed enteral nutrition without dietary fiber exhibited severe immune cell infiltration similar to the other active CD patients, but GPR43+ PMNs were rarely observed. The level of TNF-α mRNA in active Crohn's disease patients was higher than those of the other patients. In conclusion, the use of dietary fiber in enteral nutrition by active Crohn's disease patients might increase GPR43+ PMNs infiltration in colon mucosa. This effect was not observed in Crohn's disease patients in remission.

Endostatin is a well-known angiogenesis inhibitor. Although angiogenesis has been considered as a potential therapeutic target of obesity, the inhibitory effect of endostatin on adipogenesis and dietary-induced obesity has never been demonstrated. Adipogenesis plays a critical role in controlling adipocyte cell number, body weight, and metabolic profile in a homeostatic state. Here we reveal that endostatin inhibits adipogenesis and dietary-induced obesity. The antiadipogenic mechanism of endostatin lies in its interaction with Sam68 RNA-binding protein in the nuclei of preadipocytes. This interaction competitively impairs the binding of Sam68 to intron 5 of mammalian target of rapamycin (mTOR), causing an error in mTOR transcript. This consequently decreases the expression of mTOR, results in decreased activities of the mTOR complex 1 pathway, and leads to defects in adipogenesis. Moreover, our findings demonstrate that the antiangiogenic function of endostatin also contributes to its obesity-inhibitory activity. Through the combined functions on adipogenesis and angiogenesis, endostatin prevents dietary-induced obesity and its related metabolic disorders, including insulin resistance, glucose intolerance, and hepatic steatosis. Thus, our findings reveal that endostatin has a potential application for antiobesity therapy and the prevention of obesity-related metabolic syndromes.

In this in-vitro study, the effect of prohibitin (PHB) on glucose metabolism in eutopic endometrial stromal cells from women with endometriosis was investigated. Endometrial stromal cells were isolated from endometrium in women with endometriosis, in women without endometriosis, or from endometrioma tissues. Glucose metabolic phenotype of stromal cells were examined in vitro. Quantitative polymerase chain reaction was used to measure the mRNA expression of glycolysis-related genes. Glucose consumption and lactate production were examined after knockdown of PHB expression in women with endometriosis with siRNA. In endometrioma tissue, significantly increased glucose consumption, lactate production and aberrant expression of glycolysis-related enzymes were found in women with endometriosis compared with women who do not have endometriosis (P < 0.05 versus P < 0.001). In women with endometriosis, PHB mRNA and protein were under-expressed in endometrioma tissue; in women without endometriosis, PHB mRNA and protein were over-expressed. Knockdown of PHB expression in women with endometriosis increased glucose consumption, although it had no effect on lactate production. This study suggests that aberrant expression of glycolysis-related enzymes in endometrioma tissue is associated with enhanced glycolytic metabolism. The malignant-like feature may be partially caused by low-expression of PHB gene in endometriotic stromal cells.

Carbonic anhydrase IX (CA IX), a hypoxia-inducible protein in tumors, has been shown to be valuable for the prognosis of nasopharyngeal carcinoma (NPC). However, the function and mechanism of CA IX has been not explored in NPC. Here, we found that CA IX was detected at higher levels in NPC cells and tissues than their corresponding partners. Furthermore, the cell growth, migration and invasion in vitro were altered with shRNA or overexpression of CA IX in NPC cells. More importantly, the metastatic ability of NPC cells stably expressing CA IX was significantly enhanced using the hepatic metastasis model of nude mice in vivo. Finally, the mTOR pathway was indicated to be involved in such effects of CA IX on NPC. This is the first evidence that CA IX may promote the NPC metastasis to potentially be a therapeutic target for NPC, and that the inhibitory molecules of CA IX and/or the mTOR pathway alone or combination with both may be worth to have a clinical trial for the patients with NPC.

Curcumin (diferuloylmethane) is a polyphenol natural product of the plant Curcuma longa, and has a diversity of antitumor activities. However, the clinical application of curcumin remains limited due to its poor pharmacokinetic characteristics. It is therefore critical to develop structural analogues of curcumin with increasing anticancer activity. T63, a new 4-arylidene curcumin analogue, was synthesized in our previous studies and exhibited higher in vitro and in vivo anti-tumor activities compared to curcumin. However, the precise molecular mechanism of its anti-tumor effects has not been well elucidated. Using a two-dimensional gel electrophoresis (2-DE)-based proteomic approach, we identified 66 differentially expressed proteins. Similarly to curcumin, T63 showed a diverse range of molecular targets. We proposed that induction of ROS generation and mitochondrial dysfunction, inhibition of proteasome, HSP90, and 14-3-3 proteins play important roles in T63-induced cell cycle arrest and apoptosis. These data indicate that the novel curcumin analogue T63 is a potent anti-tumor agent, which can induce cell cycle arrest and apoptosis, and also provided valuable resources for further study of the anti-tumor effects and molecular mechanisms of T63.

Metal-organic frameworks (MOFs) possess unique properties desirable for delivery of drugs and gaseous therapeutics, but their uncharacterized interactions with cells raise increasing concerns of their safety in such biomedical applications. We evaluated the adverse effects of zinc nanoscale MOFs on the cell morphology, cytoskeleton, cell viability and expression of neurotrophin signaling pathway-associated GAP-43 protein in rat pheochromocytoma PC12 cells. At the concentration of 25 μg/ml, zinc MOFs did not significantly affect morphology, viability and membrane integrity of the cells. But at higher concentrations (over 100 μg/ml), MOFs exhibited a time- and concentration-dependent cytotoxicity, indicating their entry into the cells via endocytosis where they release Zn(2+) into the cytosol to cause increased intracellular concentration of Zn(2+). We demonstrated that the toxicity of MOFs was associated with a disrupted cellular zinc homeostasis and down-regulation of GAP-43 protein, which might be the underlying mechanism for the improved differentiation in PC12 cells. These findings highlight the importance of cytotoxic evaluation of the MOFs before their biomedical application.

Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress.

In Western blotting, a suitable loading control is indispensable for correcting errors in the total amount of loaded protein. Immunodetection of housekeeping proteins and total protein staining have traditionally been used as loading control methods. Direct Blue 71 (DB71) staining-a novel, sensitive, dye-binding staining method compatible with immunodetection-may offer advantages over these traditional loading control methods. Three common neuroscientific samples (human plasma, human oligodendrocytes, and rat brain) were employed to assess DB71 staining as a loading control method for Western blotting. DB71, CBB, one traditional housekeeping protein, and one protein of interest were comparatively assessed for reliability and repeatability and linear dynamic range over 2.5-40 μg of protein loaded. DB71's effect on the reliability and repeatability and linear dynamic range of immunoreaction were also assessed. Across all three sample types, DB71 was either equivalent or superior to CBB and housekeeping protein-based methods in terms of reliability and repeatability and linear dynamic range. Across all three sample types, DB71 staining did not impair the reliability and repeatability or linear dynamic range of immunoreaction. Our results demonstrate that the DB71 staining can be used as a destaining-free alternative loading control method for Western blotting.

microRNAs (miRNAs) are short non-coding RNA molecules, which post-transcriptionally regulate genes expression and play crucial roles in diverse biological processes, such as development, differentiation, apoptosis, and proliferation. Here, we investigated the possible role of miRNAs in the development of drug resistance in human lung cancer cell line. We found that miR-135a/b were downregulated while MCL1 was upregulated in A549/CDDP (cisplatin) cells, compared with the parental A549 cells. In vitro drug sensitivity assay demonstrated that overexpression of miR-135a/b sensitized A549/CDDP cells to cisplatin. The luciferase activity of MCL1 3'-untranslated region-based reporter constructed in A549/CDDP cells suggested that MCL1 was the direct target gene of miR-135a/b. Enforced miR-135a/b expression reduced MCL1 protein level and sensitized A549/CDDP cells to CDDP-induced apoptosis. Taken together, our findings first suggested that hsa-miR-135a/b could play a role in the development of CDDP resistance in lung cancer cell line at least in part by modulation of apoptosis via targeting MCL1.

The multidrug resistance 1 (MDR1) gene product P-glycoprotein is an ATP-dependent efflux pump associated with chemotherapy failure in breast cancer. In the present study, we show that paclitaxel induces MDR1 expression in the MCF-7 breast cancer cell line in a MAPK/Egr-1-dependent manner. Paclitaxel exposure activated the Erk1/2/MAPK pathway and promoted the accumulation of the early response transcription factor Egr-1 in MCF-7 cells. Egr-1 binds to the GC element on the proximal MDR1 promoter to enhance MDR1 transcription. Loss of Egr-1 function in paclitaxel-resistant MCF-7 cells decreased MDR1 expression, whereas inhibiting Erk1/2 activity reduced both Egr-1 accumulation and MDR1 expression. These findings suggest that Erk1/2-induced Egr-1 accumulation activates MDR1 transcription and thereby induces the drug resistance observed in paclitaxel-resistant MCF-7 cells. Further mechanistic studies indicate that Egr-1 most likely does not induce the constitutive activation of Erk1/2 through its target gene geranylgeranyl diphosphate synthase (GGPPS), which regulates Ras prenylation. Indeed, our results suggest a novel pathway by which paclitaxel induces MDR1 expression, possibly illuminating a potential target pathway for the prevention of MDR1-mediated drug resistance.

Ribose-phosphate pyrophosphokinase 1 (PRPS1) was identified and isolated as a differentially expressed gene between deltamethrin-susceptible (DS) and deltamethrin-resistant (DR) Culex pipiens pallens and Aedes albopictus C6/36 cell line through microarray and 2D-Gel. An open reading frame of PRPS1 cloned from C. pipiens pallens has 1,011 bp and encodes for a 336 amino acids protein which shares high homology with Culex quinquefasciatus. Real-time polymerase chain reaction was used to determine the transcript expression level of PRPS1 in DS and DR strains. The expression levels of PRPS1 were higher in DR laboratory strains and natural population JXZ-DR, JXZ-LDR. PRPS1 was also detected and expressed at all developmental stages of C. pipiens pallens and increased expression level in DR3 strain than DS strain in the third and fourth instar larvae, female and male stages. In addition, to further investigate the role of PRPS1 in deltamethrin resistance, PRPS1 was transiently expressed in A. albopictus C6/36 cells and detected by western blotting. Cells transfected with PRPS1 had an increased resistance to deltamethrin compared with control cells. These results suggested that the increased expression level of PRPS1 may play roles in the regulation of deltamethrin resistance.

Although major depressive disorder (MDD) is a serious neuropsychiatric illness, it's pathogenesis remains unclear. Current evidence suggests that the abnormal transmission and plasticity of hippocampal synapses play an important role in the pathogenesis of MDD. In this study, a two-dimensional gel-based proteomic approach to profile alterations of synaptosome protein expression was applied in the hippocampus of rats subjected to chronic mild stress. Through mass spectrometry and database searching, 19 differentially expressed proteins were identified, of which 5 were up-regulated and 14 were down-regulated in the chronic mild-stressed group as compared with the control group. Subsequently, several proteins of interest were further validated by Western blotting. A detailed analysis of protein functions and disease relevance revealed that synaptic exo/endocytosis-associated proteins were dysregulated in the chronic mild-stressed rats. The present study is the first reported synaptoproteomic analysis of the chronic mild-stressed rat hippocampus. The synaptic exo/endocytosis-associated proteins may participate in a central mechanism that underlies the abnormal transmission and plasticity of hippocampal synapses found in the chronic mild-stressed rats, and provides guidance to advance our understanding of the pathogenesis of MDD.

Pulmonary artery hypertension (PAH) is a severe disease characterized with progressive increase of pulmonary vascular resistance that finally causes right ventricular failure and premature death. Cigarette smoke (CS) is a major factor of Chronic Obstructive Pulmonary Disease (COPD) that can lead to PAH. However, the mechanism of CS-induced PAH is poorly understood. Mounting evidence supports that pulmonary vascular remodeling play an important role in the development of PAH. PDGF signaling has been demonstrated to be a major mediator of vascular remodeling implicated in PAH. However, the association of PDGF signaling with CS-induced PAH has not been documented. In this study, we investigated CS-induced PAH in rats and the expression of platelet derived growth factor (PDGF) and PDGF receptor (PDGFR) in pulmonary artery. Forty male rats were randomly divided into control group and three experimental groups that were exposed to CS for 1, 2, and 3 months, respectively. CS significantly increased right ventricular systolic pressure (RVSP) and right ventricular hypertrophy index (RVHI). Histology staining demonstrated that CS significantly increased the thickness of pulmonary artery wall and collagen deposition. The expression of PDGF isoform B (PDGF-B) and PDGF receptor beta (PDGFRβ) were significantly increased at both protein and mRNA levels in pulmonary artery of rats with CS exposure. Furthermore, Cigarette smoke extract (CSE) significantly increased rat pulmonary artery smooth muscle cell (PASMC) proliferation, which was inhibited by PDGFR inhibitor Imatinib. Thus, our data suggest PDGF signaling is implicated in CS-induced PAH.

The microRNA miR-138 is dysregulated in several human cancers, but the underlying mechanism remains largely unknown. Here, we report that miR-138 is commonly underexpressed in nasopharyngeal carcinoma (NPC) specimens and NPC cell lines. The ectopic expression of miR-138 dramatically suppressed cell proliferation and colony formation in vitro and inhibited tumorigenesis in vivo. Moreover, we identified the cyclin D1 (CCND1) gene as a novel direct target of miR-138. In consistent with the knocked-down expression of CCND1, overexpression of miR-138 inhibited cell growth and cell cycle progression in NPC cells. Furthermore, CCND1 was widely upregulated in NPC tumors, and its mRNA levels were inversely correlated with miR-138 expression. Taken together, our findings suggest that miR-138 might be a tumor suppressor in NPC, which is exerted partially by inhibiting CCND1 expression. The identification of functional miR-138 in NPC and its direct link to CCND1 might provide good candidates for developing diagnostic markers and therapeutic applications for NPC.

Multidrug resistance (MDR) is a major barrier for chemotherapy of many cancers. Non-ionic surfactants have great potential to reverse the MDR by preventing onset or delay progression of the carcinogenic process. However, the role of Tween-20 in the development of MDR remains unknown. The aim of this study was to explore the reversal effect and potential mechanism of Tween-20 on tumor cells in vitro. Alamar Blue assay was used to examine the reversal index of Tween-20 to vincristine (VCR), doxorubicin (DOX) and 5-fluorouracil (5-FU) in KBv200, HepG2/R and Bel-7402/5-FU, respectively. Morphological change was determined by Gimsa and Hoechst 33258 staining. The acumulation of DOX was confirmed by spectrofluorimetric assay. Cell cycle analysis was performed using flow cytometry. The mRNA and protein expression levels of MDR were assessed by semiquantitative RT-PCR and dot blot, respectively. The results showed that Tween-20 at concentrations of 0.0025%, 0.005%, 0.01% had little cytotoxicity. When combined with the cancer drugs, it significantly promoted the sensitivity of MDR cells. Fluorescence staining confirmed that the percentage of apoptotic cell increased when combined with Tween-20. This notion was further supported by the observation that Tween-20 treatment potentiated VIN-induced G2/M arrest of the cell cycle. Furthermore, Tween-20 treatment increased significantly intracellular accumulation of DOX. RT-PCR and dot blot revealed that Tween-20 could downregulate the expression of MDR and P-glycoprotein. Low concentrations of Tween-20 can efficiently reverse the multidrug resistance phenotype by enhancing accumulation of the anticancer drugs. The potential mechanism may be via inhibiting the multidrug-resistant gene expression.

In mammals, the type II melanoma antigen (MAGE) protein family is constituted by at least ten closely related members, but our understanding of their function in the developing nervous system remains poor. To systematically study the expression pattern of type II MAGE genes during neurogenesis, we employed mouse embryonic carcinoma P19 cells as an in vitro model for neural differentiation by retinoic acid (RA) induction. The expression of type II MAGE genes was investigated under distinct steps of differentiation by a comparative ΔΔC (T) paradigm of real-time quantitative reverse-transcription PCR (qRT-PCR). The relative levels of each gene expression at various steps of differentiation were expressed as a fold change compared with that in RA-untreated P19 cells. The results revealed that: (1) the expression of MAGE-E1, E2, and Necdin transcripts was steadily increased, and the relative levels of MAGE-D1, D2, D3, F1, G1, and H1 mRNA were fluctuantly elevated after the RA-treatment at embryoid body and neural stages; (2) during RA-treatment and subsequent differentiation, the expression of MAGE-L2 mRNA was decreased. Therefore, our results suggested that MAGE-D1, D2, D3, E1, E2, F1, G1, H1, and Necdin might be involved in the early process of neurogenesis, and MAGE-L2 connected with maintenance of pluripotency of stem cells. These studies may present some clues for a better understanding of the fundamental aspects of type II MAGE genes during neurogenesis.

Artemisinin (Art) is a sesquiterpene trioxane lactone from Artemisia annua L., which has been shown to affect immune responses. However, the underlying mechanism remains elusive. In this study, we examined the anti-inflammatory and immunomodulatory effects of Art in a mouse model of contact hypersensitivity (CHS), a T-cell-mediated cutaneous inflammatory reaction. The data showed that topical administration of Art could suppress CHS response and Con A-induced T cell proliferation effectively. Further experiments indicated that Art induced the generation of regulatory T cells (Tregs) and impaired the phosphorylation of AKT, associated with the up-regulation of p38 MAPK activation. Moreover, Art also exerted a strikingly inhibitory effect on IL-17 production, and diminished the level of IL-6 paralleled with an enhancement of TGF-β, which effects were coupled with a significant reduction of STAT3 activation. These data reveal that Art could effectively block CHS response in mice by inducing the generation of Tregs and suppressing the development of Th17, indicating the potential of Art to be applied as an effective therapeutic agent for treating immune-related diseases.

A variety of evidence has a connection with hippocampal neurogenesis in the pathophysiology of depression. However, whether other neurogenic regions in the adult central nervous system would likewise be involved is a highly interesting question. The olfactory bulb (OB) is one of the post-developmental neurogenesis areas in the adult mammalian brain. Clinical studies have shown a decreased olfactory sensitivity in depressed patients, and a recent study disclosed cases of reduced OB volume in acute major depression, indicating the OB may be also affected. Here, animal models are superior to human studies, which may provide further insight into such complex processes. We therefore investigated OB neurogenesis using a chronic unpredictable mild stress (CUMS) rat model of depression. Considering the functional analysis of adult neurogenesis which has been carried out at the synaptic level as well as animal behavior level, we detected pre-synaptic and olfactory function in the OB of rats after 4 weeks of chronic stress. Immunohistochemistry and Western blot analysis showed a dramatic reduction of immature neurons marked by polysialylated neural cell adhesion molecule and doublecortin as well as mature neurons labeled by neuronal nuclei. Moreover, chronic stress down-regulated the expression of synaptophsin but up-regulated syntaxin in the OB, as demonstrated by Western blot, whereas a significant variation at the mRNA level was lacking. Notably, in the rat model of depression, both a decreased OB volume and olfactory dysfunction were present at the same time, which is consistent with clinical findings in depressed patients. In summary, reduced OB neurogenesis and pre-synaptic dysfunction were observed in the rat model, which may at least in part correspond to the reduced OB volume and olfactory malfunction in patients suffering from depression.

Regulation of neuronal NMDA receptor (NMDAR) is critical in synaptic transmission and plasticity. Protein kinase C (PKC) promotes NMDAR trafficking to the cell surface via interaction with NMDAR-associated proteins (NAPs). Little is known, however, about the NAPs that are critical to PKC-induced NMDAR trafficking. Here, we showed that calcium/calmodulin-dependent protein kinase II (CaMKII) could be a NAP that mediates the potentiation of NMDAR trafficking by PKC. PKC activation promoted the level of autophosphorylated CaMKII and increased association with NMDARs, accompanied by functional NMDAR insertion, at postsynaptic sites. This potentiation, along with PKC-induced long term potentiation of the AMPA receptor-mediated response, was abolished by CaMKII antagonist or by disturbing the interaction between CaMKII and NR2A or NR2B. Further mutual occlusion experiments demonstrated that PKC and CaMKII share a common signaling pathway in the potentiation of NMDAR trafficking and long-term potentiation (LTP) induction. Our results revealed that PKC promotes NMDA receptor trafficking and induces synaptic plasticity through indirectly triggering CaMKII autophosphorylation and subsequent increased association with NMDARs.

ETHNOPHARMACOLOGICAL RELEVANCE:

Rehmanniae Radix (RR) and Cornus officinalis (CO) are two traditional Chinese medicines widely used in China for treating diabetes mellitus and its complications, such as diabetic nephropathy. Iridoid glycoside of Cornus officinalis (IGCO), triterpenoid acid of Cornus officinalis (TACO) and iridoid glycoside of Rehmanniae Radix (IGRR) formed an innovative formula named combinatorial bioactive parts (CBP). The aims of the present study were to investigate the renoprotective effects of CBP on DN through the inhibition of AGEs/RAGE/SphK1 signaling pathway activation, and identify the advantage of CBP compared with IGCO, TACO, IGRR.

MATERIALS AND METHODS:

The db/db diabetic renal injury model was used to examine the renoprotective effects of CBP, IGCO, TACO and IGRR. For mechanistic studies, diabetic symptoms, renal functions, and pathohistology of pancreas and kidney were evaluated. AGEs/RAGE/SphK1 pathway were determined.

RESULTS:

CBP, IGCO, TACO and IGRR inhibited the decrease in serum insulin levels and the increases in urine volume, food consumption, water intake, TC, TG, glycated serum protein, fasting blood glucose levels, 24h urine protein levels, and serum levels of urea nitrogen and creatinine. It also prevented ECM accumulation and improved the histology of pancreas and kidney, and alleviated the structural alterations in mesangial cells and podocytes in renal cortex. Moreover, CBP, IGCO, TACO and IGRR down-regulated the elevated staining, protein levels of RAGE, SphK1, TGF-β and NF-κB. Among the treatment groups, CBP produced the strongest effects.

CONCLUSIONS:

These findings suggest that the inhibitory effect of CBP, IGCO, TACO and IGRR on the activation of AGEs/RAGE/SphK1 signaling pathway in db/db diabetic mice kidney is a novel mechanism by which CBP, IGCO, TACO and IGRR exerts renoprotective effects on DN. Among all the groups, CBP produced the strongest effect while IGCO, TACO and IGRR produced weaker effects.

Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

BACKGROUND AND AIMS:

Specific members of the RING finger [RNF] protein family serve as E3 ubiquitin ligases and play important roles in the regulation of inflammation. However, their roles in the pathogenesis of inflammatory bowel disease [IBD] have not been explored.

METHODS:

Genomic microarray of inflamed colon samples from Crohn's disease [CD] patients was performed to identify potential up-regulated genes. Expression of the identified highly up-regulated RNF183 gene was subsequently examined by quantitative reverse transcription polymerase chain reaction [qRT-PCR], western blotting and immunohistochemistry of the intestinal tissues of IBD patients and the colons of trinitrobenzene sulphonic acid [TNBS]-induced colitic mice. RNF183-mediated interaction with the NF-κB pathway and ubiquitination of IκBα were examined by siRNA, plasmid transfection, and immunoprecipitation. The miRNA predicted to target RNF183 was explored and its role in the RNF183/ NF-κB pathway was investigated.

RESULTS:

RNF183 was up-regulated in intestinal epithelial cells in IBD patients and in colitic mice. RNF183 promoted intestinal inflammation via the activation of the NF-κB pathway by increasing the ubiquitination and degradation of IκBα. Computational analysis identified putative binding of miR-7 to RNF183. Transfection of intestinal cells with a miR-7 mimic or inhibitor confirmed its negative regulatory effect on RNF183 expression and ubiquitination of IκBα. miR-7 was down-regulated in inflamed colon tissues of IBD patients and colitic mice.

CONCLUSIONS:

RNF183, which is negatively regulated by miR-7, is a novel regulator promoting intestinal inflammation by increasing the ubiquitination and degradation of IκBα, thereby inducing NF-κB activation. The interaction between RNF183-mediated ubiquitination and miRNA may be an important novel epigenetic mechanism in the pathogenesis of IBD.

Copyright © 2016 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

OBJECTIVES:

To evaluate the regulation mechanism of heat shock protein 27 (HSP27) on gemcitabine (GEM) resistance of pancreatic cancer cell.

METHODS:

The expression vectors pEGFP-C1-HSP27 and the vectors of MicroRNA targeting Snail were introduced into GEM-sensitive pancreatic cancer SW1990 cells, and the vectors of small hairpin RNA targeting HSP27 were transfected into SW1990 and GEM-resistant SW1990/GEM cells. The expressions of HSP27, p-HSP27 (Ser82), Snail, ERCC1, and E-cadherin were evaluated by Western blotting. The sensitivity of transfected cells to GEM was detected by CCK-8 assay and Annexin V-FITC apoptosis assay.

RESULTS:

As compared to SW1990, SW1990/GEM showed significantly increased expressions of HSP27, p-HSP27, Snail and ERCC1 with decreased expression of E-cadherin. By increasing HSP27 expression, we found increase of Snail and ERCC1 with reduction of E-cadherin expressions, while reduction of HSP27 expression caused reduction of Snail and ERCC1 but increase of E-cadherin expressions. Downregulation of Snail resulted in the reduction of ERCC1 expression and increase of E-cadherin. Furthermore, downregulation of HSP27 or snail caused increased GEM sensitivity of pancreatic cancer cells, and upregulation of HSP27 showed the opposite results.

CONCLUSIONS:

There is an inverse correlation between HSP27 expression and GEM sensitivity of SW1990 cells, which might be realized by regulating E-cadherin and ERCC1 expressions through Snail.